ID: 1120269727

View in Genome Browser
Species Human (GRCh38)
Location 14:82296158-82296180
Sequence CCTTGGCTCCCCTGGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120269722_1120269727 -6 Left 1120269722 14:82296141-82296163 CCCTCAGACGGAGACATCCTTGG No data
Right 1120269727 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data
1120269724_1120269727 -7 Left 1120269724 14:82296142-82296164 CCTCAGACGGAGACATCCTTGGC No data
Right 1120269727 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120269727 Original CRISPR CCTTGGCTCCCCTGGTTGTC AGG Intergenic
No off target data available for this crispr