ID: 1120269729

View in Genome Browser
Species Human (GRCh38)
Location 14:82296167-82296189
Sequence CAGTTCAAGCCTGACAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120269729_1120269738 29 Left 1120269729 14:82296167-82296189 CCCTGGTTGTCAGGCTTGAACTG No data
Right 1120269738 14:82296219-82296241 AGCTTGCAGATGGCACATCATGG No data
1120269729_1120269734 1 Left 1120269729 14:82296167-82296189 CCCTGGTTGTCAGGCTTGAACTG No data
Right 1120269734 14:82296191-82296213 TTTGCAACACAGGCGTTCCTGGG No data
1120269729_1120269736 19 Left 1120269729 14:82296167-82296189 CCCTGGTTGTCAGGCTTGAACTG No data
Right 1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG 0: 69
1: 240
2: 465
3: 620
4: 1450
1120269729_1120269733 0 Left 1120269729 14:82296167-82296189 CCCTGGTTGTCAGGCTTGAACTG No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data
1120269729_1120269732 -9 Left 1120269729 14:82296167-82296189 CCCTGGTTGTCAGGCTTGAACTG No data
Right 1120269732 14:82296181-82296203 CTTGAACTGGTTTGCAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120269729 Original CRISPR CAGTTCAAGCCTGACAACCA GGG (reversed) Intergenic
No off target data available for this crispr