ID: 1120269730

View in Genome Browser
Species Human (GRCh38)
Location 14:82296168-82296190
Sequence CCAGTTCAAGCCTGACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120269730_1120269732 -10 Left 1120269730 14:82296168-82296190 CCTGGTTGTCAGGCTTGAACTGG No data
Right 1120269732 14:82296181-82296203 CTTGAACTGGTTTGCAACACAGG No data
1120269730_1120269734 0 Left 1120269730 14:82296168-82296190 CCTGGTTGTCAGGCTTGAACTGG No data
Right 1120269734 14:82296191-82296213 TTTGCAACACAGGCGTTCCTGGG No data
1120269730_1120269733 -1 Left 1120269730 14:82296168-82296190 CCTGGTTGTCAGGCTTGAACTGG No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data
1120269730_1120269738 28 Left 1120269730 14:82296168-82296190 CCTGGTTGTCAGGCTTGAACTGG No data
Right 1120269738 14:82296219-82296241 AGCTTGCAGATGGCACATCATGG No data
1120269730_1120269736 18 Left 1120269730 14:82296168-82296190 CCTGGTTGTCAGGCTTGAACTGG No data
Right 1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120269730 Original CRISPR CCAGTTCAAGCCTGACAACC AGG (reversed) Intergenic