ID: 1120269733

View in Genome Browser
Species Human (GRCh38)
Location 14:82296190-82296212
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120269730_1120269733 -1 Left 1120269730 14:82296168-82296190 CCTGGTTGTCAGGCTTGAACTGG No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data
1120269722_1120269733 26 Left 1120269722 14:82296141-82296163 CCCTCAGACGGAGACATCCTTGG No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data
1120269729_1120269733 0 Left 1120269729 14:82296167-82296189 CCCTGGTTGTCAGGCTTGAACTG No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data
1120269724_1120269733 25 Left 1120269724 14:82296142-82296164 CCTCAGACGGAGACATCCTTGGC No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data
1120269726_1120269733 9 Left 1120269726 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data
1120269728_1120269733 1 Left 1120269728 14:82296166-82296188 CCCCTGGTTGTCAGGCTTGAACT No data
Right 1120269733 14:82296190-82296212 GTTTGCAACACAGGCGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120269733 Original CRISPR GTTTGCAACACAGGCGTTCC TGG Intergenic