ID: 1120269736

View in Genome Browser
Species Human (GRCh38)
Location 14:82296209-82296231
Sequence CTGGGTCTCCAGCTTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120269730_1120269736 18 Left 1120269730 14:82296168-82296190 CCTGGTTGTCAGGCTTGAACTGG No data
Right 1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG No data
1120269726_1120269736 28 Left 1120269726 14:82296158-82296180 CCTTGGCTCCCCTGGTTGTCAGG No data
Right 1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG No data
1120269729_1120269736 19 Left 1120269729 14:82296167-82296189 CCCTGGTTGTCAGGCTTGAACTG No data
Right 1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG No data
1120269728_1120269736 20 Left 1120269728 14:82296166-82296188 CCCCTGGTTGTCAGGCTTGAACT No data
Right 1120269736 14:82296209-82296231 CTGGGTCTCCAGCTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120269736 Original CRISPR CTGGGTCTCCAGCTTGCAGA TGG Intergenic