ID: 1120272491

View in Genome Browser
Species Human (GRCh38)
Location 14:82331249-82331271
Sequence AGTGAGCCCAAAGGTTGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120272491_1120272497 26 Left 1120272491 14:82331249-82331271 CCCTACCAACCTTTGGGCTCACT No data
Right 1120272497 14:82331298-82331320 CTCTTTCTCCATCAGCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120272491 Original CRISPR AGTGAGCCCAAAGGTTGGTA GGG (reversed) Intergenic