ID: 1120275315

View in Genome Browser
Species Human (GRCh38)
Location 14:82366211-82366233
Sequence GTGGCAGATGATGCAGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120275315_1120275320 -1 Left 1120275315 14:82366211-82366233 CCAAAAACTGCATCATCTGCCAC No data
Right 1120275320 14:82366233-82366255 CCACCATTGGTCAACAGAAAGGG No data
1120275315_1120275318 -2 Left 1120275315 14:82366211-82366233 CCAAAAACTGCATCATCTGCCAC No data
Right 1120275318 14:82366232-82366254 ACCACCATTGGTCAACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120275315 Original CRISPR GTGGCAGATGATGCAGTTTT TGG (reversed) Intergenic
No off target data available for this crispr