ID: 1120280893

View in Genome Browser
Species Human (GRCh38)
Location 14:82436560-82436582
Sequence CTCCATCTTGAAATCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120280893_1120280896 3 Left 1120280893 14:82436560-82436582 CCTTGCTGGATTTCAAGATGGAG No data
Right 1120280896 14:82436586-82436608 GTCACATGCCAAAAAAATGCTGG No data
1120280893_1120280898 26 Left 1120280893 14:82436560-82436582 CCTTGCTGGATTTCAAGATGGAG No data
Right 1120280898 14:82436609-82436631 TGTCCTCTTGAAGCAGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120280893 Original CRISPR CTCCATCTTGAAATCCAGCA AGG (reversed) Intergenic
No off target data available for this crispr