ID: 1120281459

View in Genome Browser
Species Human (GRCh38)
Location 14:82443675-82443697
Sequence AAGAAGAAGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120281459_1120281463 -3 Left 1120281459 14:82443675-82443697 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1120281463 14:82443695-82443717 CTTCTTCTTCTTCTTTGAGATGG No data
1120281459_1120281465 23 Left 1120281459 14:82443675-82443697 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1120281465 14:82443721-82443743 TCTCGCTATGTTGCCCAGGCTGG 0: 1456
1: 35406
2: 139229
3: 233963
4: 370255
1120281459_1120281464 19 Left 1120281459 14:82443675-82443697 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1120281464 14:82443717-82443739 GAGATCTCGCTATGTTGCCCAGG 0: 27
1: 674
2: 6097
3: 24915
4: 71918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120281459 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr