ID: 1120282447

View in Genome Browser
Species Human (GRCh38)
Location 14:82456532-82456554
Sequence TGATAATTAAACAACCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120282446_1120282447 -7 Left 1120282446 14:82456516-82456538 CCAAAATTAGTTTCACTGATAAT No data
Right 1120282447 14:82456532-82456554 TGATAATTAAACAACCTGACAGG No data
1120282444_1120282447 21 Left 1120282444 14:82456488-82456510 CCTGGCAGTGACCACTTTAACAA No data
Right 1120282447 14:82456532-82456554 TGATAATTAAACAACCTGACAGG No data
1120282445_1120282447 10 Left 1120282445 14:82456499-82456521 CCACTTTAACAATGTCACCAAAA No data
Right 1120282447 14:82456532-82456554 TGATAATTAAACAACCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120282447 Original CRISPR TGATAATTAAACAACCTGAC AGG Intergenic
No off target data available for this crispr