ID: 1120286117

View in Genome Browser
Species Human (GRCh38)
Location 14:82504233-82504255
Sequence CAAACAATTCCCTAAGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120286116_1120286117 14 Left 1120286116 14:82504196-82504218 CCTGTTTTACAATTTAGCTTAGA No data
Right 1120286117 14:82504233-82504255 CAAACAATTCCCTAAGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120286117 Original CRISPR CAAACAATTCCCTAAGTAAC AGG Intergenic