ID: 1120286117 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:82504233-82504255 |
Sequence | CAAACAATTCCCTAAGTAAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1120286116_1120286117 | 14 | Left | 1120286116 | 14:82504196-82504218 | CCTGTTTTACAATTTAGCTTAGA | No data | ||
Right | 1120286117 | 14:82504233-82504255 | CAAACAATTCCCTAAGTAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1120286117 | Original CRISPR | CAAACAATTCCCTAAGTAAC AGG | Intergenic | ||