ID: 1120299751

View in Genome Browser
Species Human (GRCh38)
Location 14:82691571-82691593
Sequence CCACTTTCCCAGCCTACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120299751_1120299756 -10 Left 1120299751 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG No data
Right 1120299756 14:82691584-82691606 GGGAAAGTGGGCTGGGTCAGAGG No data
1120299751_1120299757 6 Left 1120299751 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG No data
Right 1120299757 14:82691600-82691622 TCAGAGGCAAGAAGCTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120299751 Original CRISPR CCACTTTCCCAGCCTACCTC TGG (reversed) Intergenic
No off target data available for this crispr