ID: 1120299752

View in Genome Browser
Species Human (GRCh38)
Location 14:82691571-82691593
Sequence CCAGAGGTAGGCTGGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120299744_1120299752 4 Left 1120299744 14:82691544-82691566 CCAGAGAAGCTTTTTAGCAGCTA No data
Right 1120299752 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG No data
1120299742_1120299752 26 Left 1120299742 14:82691522-82691544 CCTTAGGCCTGCAGCTCTGCTGC No data
Right 1120299752 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG No data
1120299743_1120299752 19 Left 1120299743 14:82691529-82691551 CCTGCAGCTCTGCTGCCAGAGAA No data
Right 1120299752 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120299752 Original CRISPR CCAGAGGTAGGCTGGGAAAG TGG Intergenic
No off target data available for this crispr