ID: 1120301846

View in Genome Browser
Species Human (GRCh38)
Location 14:82717470-82717492
Sequence GTGAATAAACAAATCTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120301846_1120301847 -5 Left 1120301846 14:82717470-82717492 CCTTTGAAGATTTGTTTATTCAC No data
Right 1120301847 14:82717488-82717510 TTCACTTATTTATTCGTTTTTGG No data
1120301846_1120301850 21 Left 1120301846 14:82717470-82717492 CCTTTGAAGATTTGTTTATTCAC No data
Right 1120301850 14:82717514-82717536 GGAAATATCTTTGAGTGGAGAGG No data
1120301846_1120301851 22 Left 1120301846 14:82717470-82717492 CCTTTGAAGATTTGTTTATTCAC No data
Right 1120301851 14:82717515-82717537 GAAATATCTTTGAGTGGAGAGGG No data
1120301846_1120301848 0 Left 1120301846 14:82717470-82717492 CCTTTGAAGATTTGTTTATTCAC No data
Right 1120301848 14:82717493-82717515 TTATTTATTCGTTTTTGGTATGG No data
1120301846_1120301849 16 Left 1120301846 14:82717470-82717492 CCTTTGAAGATTTGTTTATTCAC No data
Right 1120301849 14:82717509-82717531 GGTATGGAAATATCTTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120301846 Original CRISPR GTGAATAAACAAATCTTCAA AGG (reversed) Intergenic
No off target data available for this crispr