ID: 1120304057

View in Genome Browser
Species Human (GRCh38)
Location 14:82745723-82745745
Sequence TATCCCATGCTACTTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120304057_1120304059 7 Left 1120304057 14:82745723-82745745 CCTTCACCAAGTAGCATGGGATA No data
Right 1120304059 14:82745753-82745775 TGAACATCAGCATAATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120304057 Original CRISPR TATCCCATGCTACTTGGTGA AGG (reversed) Intergenic
No off target data available for this crispr