ID: 1120308086

View in Genome Browser
Species Human (GRCh38)
Location 14:82795970-82795992
Sequence CAGGATATTCAGAGAGATTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120308081_1120308086 19 Left 1120308081 14:82795928-82795950 CCACTGGTAAAGTATTTCCATAA No data
Right 1120308086 14:82795970-82795992 CAGGATATTCAGAGAGATTCCGG No data
1120308084_1120308086 -7 Left 1120308084 14:82795954-82795976 CCTGACCTTAATCTCACAGGATA No data
Right 1120308086 14:82795970-82795992 CAGGATATTCAGAGAGATTCCGG No data
1120308082_1120308086 2 Left 1120308082 14:82795945-82795967 CCATAATCTCCTGACCTTAATCT No data
Right 1120308086 14:82795970-82795992 CAGGATATTCAGAGAGATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120308086 Original CRISPR CAGGATATTCAGAGAGATTC CGG Intergenic
No off target data available for this crispr