ID: 1120308195

View in Genome Browser
Species Human (GRCh38)
Location 14:82797267-82797289
Sequence CTTCGCTGCTCCTCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120308195_1120308204 24 Left 1120308195 14:82797267-82797289 CCAGAAACAGAGGAGCAGCGAAG No data
Right 1120308204 14:82797314-82797336 CACCGGGCCATTCCACTCACAGG No data
1120308195_1120308196 7 Left 1120308195 14:82797267-82797289 CCAGAAACAGAGGAGCAGCGAAG No data
Right 1120308196 14:82797297-82797319 AGCTGATCCTTTCCCCCCACCGG No data
1120308195_1120308197 8 Left 1120308195 14:82797267-82797289 CCAGAAACAGAGGAGCAGCGAAG No data
Right 1120308197 14:82797298-82797320 GCTGATCCTTTCCCCCCACCGGG No data
1120308195_1120308205 25 Left 1120308195 14:82797267-82797289 CCAGAAACAGAGGAGCAGCGAAG No data
Right 1120308205 14:82797315-82797337 ACCGGGCCATTCCACTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120308195 Original CRISPR CTTCGCTGCTCCTCTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr