ID: 1120310733

View in Genome Browser
Species Human (GRCh38)
Location 14:82824441-82824463
Sequence CAAGATAAACACTGTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120310731_1120310733 21 Left 1120310731 14:82824397-82824419 CCTGAGGGATGGTTGTATGCATT No data
Right 1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG No data
1120310730_1120310733 22 Left 1120310730 14:82824396-82824418 CCCTGAGGGATGGTTGTATGCAT No data
Right 1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120310733 Original CRISPR CAAGATAAACACTGTGAGGT AGG Intergenic
No off target data available for this crispr