ID: 1120317318

View in Genome Browser
Species Human (GRCh38)
Location 14:82912174-82912196
Sequence TAGCAAACAGCAGTAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120317313_1120317318 12 Left 1120317313 14:82912139-82912161 CCTAATCATTGCTCTGAACTTTC No data
Right 1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG No data
1120317314_1120317318 -10 Left 1120317314 14:82912161-82912183 CCACAAGCCCAATTAGCAAACAG No data
Right 1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG No data
1120317312_1120317318 21 Left 1120317312 14:82912130-82912152 CCTGGCATGCCTAATCATTGCTC No data
Right 1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120317318 Original CRISPR TAGCAAACAGCAGTAGTGCA GGG Intergenic
No off target data available for this crispr