ID: 1120317582

View in Genome Browser
Species Human (GRCh38)
Location 14:82915736-82915758
Sequence TTGAAGTTAGATAGCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120317582_1120317586 8 Left 1120317582 14:82915736-82915758 CCCACCAGGCTATCTAACTTCAA No data
Right 1120317586 14:82915767-82915789 AATGAGGTTGTTTAGTACAATGG No data
1120317582_1120317587 30 Left 1120317582 14:82915736-82915758 CCCACCAGGCTATCTAACTTCAA No data
Right 1120317587 14:82915789-82915811 GAAAGATGCAAAACTAAATTAGG No data
1120317582_1120317585 -8 Left 1120317582 14:82915736-82915758 CCCACCAGGCTATCTAACTTCAA No data
Right 1120317585 14:82915751-82915773 AACTTCAAGTGCTACAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120317582 Original CRISPR TTGAAGTTAGATAGCCTGGT GGG (reversed) Intergenic
No off target data available for this crispr