ID: 1120317583 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:82915737-82915759 |
Sequence | CTTGAAGTTAGATAGCCTGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1120317583_1120317586 | 7 | Left | 1120317583 | 14:82915737-82915759 | CCACCAGGCTATCTAACTTCAAG | No data | ||
Right | 1120317586 | 14:82915767-82915789 | AATGAGGTTGTTTAGTACAATGG | No data | ||||
1120317583_1120317587 | 29 | Left | 1120317583 | 14:82915737-82915759 | CCACCAGGCTATCTAACTTCAAG | No data | ||
Right | 1120317587 | 14:82915789-82915811 | GAAAGATGCAAAACTAAATTAGG | No data | ||||
1120317583_1120317585 | -9 | Left | 1120317583 | 14:82915737-82915759 | CCACCAGGCTATCTAACTTCAAG | No data | ||
Right | 1120317585 | 14:82915751-82915773 | AACTTCAAGTGCTACAAATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1120317583 | Original CRISPR | CTTGAAGTTAGATAGCCTGG TGG (reversed) | Intergenic | ||