ID: 1120317583 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:82915737-82915759 |
| Sequence | CTTGAAGTTAGATAGCCTGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1120317583_1120317586 | 7 | Left | 1120317583 | 14:82915737-82915759 | CCACCAGGCTATCTAACTTCAAG | No data | ||
| Right | 1120317586 | 14:82915767-82915789 | AATGAGGTTGTTTAGTACAATGG | No data | ||||
| 1120317583_1120317587 | 29 | Left | 1120317583 | 14:82915737-82915759 | CCACCAGGCTATCTAACTTCAAG | No data | ||
| Right | 1120317587 | 14:82915789-82915811 | GAAAGATGCAAAACTAAATTAGG | No data | ||||
| 1120317583_1120317585 | -9 | Left | 1120317583 | 14:82915737-82915759 | CCACCAGGCTATCTAACTTCAAG | No data | ||
| Right | 1120317585 | 14:82915751-82915773 | AACTTCAAGTGCTACAAATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1120317583 | Original CRISPR | CTTGAAGTTAGATAGCCTGG TGG (reversed) | Intergenic | ||