ID: 1120317584

View in Genome Browser
Species Human (GRCh38)
Location 14:82915740-82915762
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120317584_1120317586 4 Left 1120317584 14:82915740-82915762 CCAGGCTATCTAACTTCAAGTGC No data
Right 1120317586 14:82915767-82915789 AATGAGGTTGTTTAGTACAATGG No data
1120317584_1120317587 26 Left 1120317584 14:82915740-82915762 CCAGGCTATCTAACTTCAAGTGC No data
Right 1120317587 14:82915789-82915811 GAAAGATGCAAAACTAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120317584 Original CRISPR GCACTTGAAGTTAGATAGCC TGG (reversed) Intergenic
No off target data available for this crispr