ID: 1120317585

View in Genome Browser
Species Human (GRCh38)
Location 14:82915751-82915773
Sequence AACTTCAAGTGCTACAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120317575_1120317585 21 Left 1120317575 14:82915707-82915729 CCGGTCCCTGTGAATCAGGAGAT No data
Right 1120317585 14:82915751-82915773 AACTTCAAGTGCTACAAATGAGG No data
1120317579_1120317585 15 Left 1120317579 14:82915713-82915735 CCTGTGAATCAGGAGATGTGGGG No data
Right 1120317585 14:82915751-82915773 AACTTCAAGTGCTACAAATGAGG No data
1120317582_1120317585 -8 Left 1120317582 14:82915736-82915758 CCCACCAGGCTATCTAACTTCAA No data
Right 1120317585 14:82915751-82915773 AACTTCAAGTGCTACAAATGAGG No data
1120317577_1120317585 16 Left 1120317577 14:82915712-82915734 CCCTGTGAATCAGGAGATGTGGG No data
Right 1120317585 14:82915751-82915773 AACTTCAAGTGCTACAAATGAGG No data
1120317583_1120317585 -9 Left 1120317583 14:82915737-82915759 CCACCAGGCTATCTAACTTCAAG No data
Right 1120317585 14:82915751-82915773 AACTTCAAGTGCTACAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120317585 Original CRISPR AACTTCAAGTGCTACAAATG AGG Intergenic
No off target data available for this crispr