ID: 1120317587

View in Genome Browser
Species Human (GRCh38)
Location 14:82915789-82915811
Sequence GAAAGATGCAAAACTAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120317584_1120317587 26 Left 1120317584 14:82915740-82915762 CCAGGCTATCTAACTTCAAGTGC No data
Right 1120317587 14:82915789-82915811 GAAAGATGCAAAACTAAATTAGG No data
1120317582_1120317587 30 Left 1120317582 14:82915736-82915758 CCCACCAGGCTATCTAACTTCAA No data
Right 1120317587 14:82915789-82915811 GAAAGATGCAAAACTAAATTAGG No data
1120317583_1120317587 29 Left 1120317583 14:82915737-82915759 CCACCAGGCTATCTAACTTCAAG No data
Right 1120317587 14:82915789-82915811 GAAAGATGCAAAACTAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120317587 Original CRISPR GAAAGATGCAAAACTAAATT AGG Intergenic
No off target data available for this crispr