ID: 1120324519

View in Genome Browser
Species Human (GRCh38)
Location 14:83008113-83008135
Sequence CAGTACACACTAGTGTAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120324519_1120324522 -8 Left 1120324519 14:83008113-83008135 CCCAATTACACTAGTGTGTACTG No data
Right 1120324522 14:83008128-83008150 GTGTACTGGAATTTTTTTTTTGG No data
1120324519_1120324523 13 Left 1120324519 14:83008113-83008135 CCCAATTACACTAGTGTGTACTG No data
Right 1120324523 14:83008149-83008171 GGTTTGTTTTGTTTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120324519 Original CRISPR CAGTACACACTAGTGTAATT GGG (reversed) Intergenic
No off target data available for this crispr