ID: 1120327566

View in Genome Browser
Species Human (GRCh38)
Location 14:83050187-83050209
Sequence GTGTCCTGGAGTCAATAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120327566_1120327571 17 Left 1120327566 14:83050187-83050209 CCAGTTTATTGACTCCAGGACAC No data
Right 1120327571 14:83050227-83050249 GTGACCCCAACTTGGCATTTGGG No data
1120327566_1120327570 16 Left 1120327566 14:83050187-83050209 CCAGTTTATTGACTCCAGGACAC No data
Right 1120327570 14:83050226-83050248 TGTGACCCCAACTTGGCATTTGG No data
1120327566_1120327569 9 Left 1120327566 14:83050187-83050209 CCAGTTTATTGACTCCAGGACAC No data
Right 1120327569 14:83050219-83050241 GTTGTTTTGTGACCCCAACTTGG No data
1120327566_1120327572 18 Left 1120327566 14:83050187-83050209 CCAGTTTATTGACTCCAGGACAC No data
Right 1120327572 14:83050228-83050250 TGACCCCAACTTGGCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120327566 Original CRISPR GTGTCCTGGAGTCAATAAAC TGG (reversed) Intergenic
No off target data available for this crispr