ID: 1120327568

View in Genome Browser
Species Human (GRCh38)
Location 14:83050201-83050223
Sequence ACAACATAACTCCAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120327568_1120327576 25 Left 1120327568 14:83050201-83050223 CCAGGACACTGGAGTTATGTTGT No data
Right 1120327576 14:83050249-83050271 GGCTCACTGTTAGCCCCCACTGG No data
1120327568_1120327571 3 Left 1120327568 14:83050201-83050223 CCAGGACACTGGAGTTATGTTGT No data
Right 1120327571 14:83050227-83050249 GTGACCCCAACTTGGCATTTGGG No data
1120327568_1120327570 2 Left 1120327568 14:83050201-83050223 CCAGGACACTGGAGTTATGTTGT No data
Right 1120327570 14:83050226-83050248 TGTGACCCCAACTTGGCATTTGG No data
1120327568_1120327572 4 Left 1120327568 14:83050201-83050223 CCAGGACACTGGAGTTATGTTGT No data
Right 1120327572 14:83050228-83050250 TGACCCCAACTTGGCATTTGGGG No data
1120327568_1120327569 -5 Left 1120327568 14:83050201-83050223 CCAGGACACTGGAGTTATGTTGT No data
Right 1120327569 14:83050219-83050241 GTTGTTTTGTGACCCCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120327568 Original CRISPR ACAACATAACTCCAGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr