ID: 1120327569

View in Genome Browser
Species Human (GRCh38)
Location 14:83050219-83050241
Sequence GTTGTTTTGTGACCCCAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120327568_1120327569 -5 Left 1120327568 14:83050201-83050223 CCAGGACACTGGAGTTATGTTGT No data
Right 1120327569 14:83050219-83050241 GTTGTTTTGTGACCCCAACTTGG No data
1120327565_1120327569 10 Left 1120327565 14:83050186-83050208 CCCAGTTTATTGACTCCAGGACA No data
Right 1120327569 14:83050219-83050241 GTTGTTTTGTGACCCCAACTTGG No data
1120327564_1120327569 11 Left 1120327564 14:83050185-83050207 CCCCAGTTTATTGACTCCAGGAC No data
Right 1120327569 14:83050219-83050241 GTTGTTTTGTGACCCCAACTTGG No data
1120327562_1120327569 30 Left 1120327562 14:83050166-83050188 CCTTTATTTGTGAGAGGTGCCCC No data
Right 1120327569 14:83050219-83050241 GTTGTTTTGTGACCCCAACTTGG No data
1120327566_1120327569 9 Left 1120327566 14:83050187-83050209 CCAGTTTATTGACTCCAGGACAC No data
Right 1120327569 14:83050219-83050241 GTTGTTTTGTGACCCCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120327569 Original CRISPR GTTGTTTTGTGACCCCAACT TGG Intergenic
No off target data available for this crispr