ID: 1120330729

View in Genome Browser
Species Human (GRCh38)
Location 14:83090249-83090271
Sequence GGGTTAAGTCATGTGCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120330729_1120330731 -4 Left 1120330729 14:83090249-83090271 CCTTTAGGCACATGACTTAACCC No data
Right 1120330731 14:83090268-83090290 ACCCATGAAAGCTGCAGTTTGGG No data
1120330729_1120330735 24 Left 1120330729 14:83090249-83090271 CCTTTAGGCACATGACTTAACCC No data
Right 1120330735 14:83090296-83090318 TTCAGCAAAACTGTGGTCATTGG No data
1120330729_1120330734 17 Left 1120330729 14:83090249-83090271 CCTTTAGGCACATGACTTAACCC No data
Right 1120330734 14:83090289-83090311 GGTTGTGTTCAGCAAAACTGTGG No data
1120330729_1120330730 -5 Left 1120330729 14:83090249-83090271 CCTTTAGGCACATGACTTAACCC No data
Right 1120330730 14:83090267-83090289 AACCCATGAAAGCTGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120330729 Original CRISPR GGGTTAAGTCATGTGCCTAA AGG (reversed) Intergenic
No off target data available for this crispr