ID: 1120330733

View in Genome Browser
Species Human (GRCh38)
Location 14:83090270-83090292
Sequence AACCCAAACTGCAGCTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120330733_1120330735 3 Left 1120330733 14:83090270-83090292 CCATGAAAGCTGCAGTTTGGGTT No data
Right 1120330735 14:83090296-83090318 TTCAGCAAAACTGTGGTCATTGG No data
1120330733_1120330740 29 Left 1120330733 14:83090270-83090292 CCATGAAAGCTGCAGTTTGGGTT No data
Right 1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG No data
1120330733_1120330734 -4 Left 1120330733 14:83090270-83090292 CCATGAAAGCTGCAGTTTGGGTT No data
Right 1120330734 14:83090289-83090311 GGTTGTGTTCAGCAAAACTGTGG No data
1120330733_1120330739 28 Left 1120330733 14:83090270-83090292 CCATGAAAGCTGCAGTTTGGGTT No data
Right 1120330739 14:83090321-83090343 CCAGCAGGTCTAAAGGACAGAGG No data
1120330733_1120330736 13 Left 1120330733 14:83090270-83090292 CCATGAAAGCTGCAGTTTGGGTT No data
Right 1120330736 14:83090306-83090328 CTGTGGTCATTGGCTCCAGCAGG No data
1120330733_1120330737 21 Left 1120330733 14:83090270-83090292 CCATGAAAGCTGCAGTTTGGGTT No data
Right 1120330737 14:83090314-83090336 ATTGGCTCCAGCAGGTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120330733 Original CRISPR AACCCAAACTGCAGCTTTCA TGG (reversed) Intergenic
No off target data available for this crispr