ID: 1120330735

View in Genome Browser
Species Human (GRCh38)
Location 14:83090296-83090318
Sequence TTCAGCAAAACTGTGGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120330732_1120330735 4 Left 1120330732 14:83090269-83090291 CCCATGAAAGCTGCAGTTTGGGT No data
Right 1120330735 14:83090296-83090318 TTCAGCAAAACTGTGGTCATTGG No data
1120330729_1120330735 24 Left 1120330729 14:83090249-83090271 CCTTTAGGCACATGACTTAACCC No data
Right 1120330735 14:83090296-83090318 TTCAGCAAAACTGTGGTCATTGG No data
1120330733_1120330735 3 Left 1120330733 14:83090270-83090292 CCATGAAAGCTGCAGTTTGGGTT No data
Right 1120330735 14:83090296-83090318 TTCAGCAAAACTGTGGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120330735 Original CRISPR TTCAGCAAAACTGTGGTCAT TGG Intergenic
No off target data available for this crispr