ID: 1120330736

View in Genome Browser
Species Human (GRCh38)
Location 14:83090306-83090328
Sequence CTGTGGTCATTGGCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120330733_1120330736 13 Left 1120330733 14:83090270-83090292 CCATGAAAGCTGCAGTTTGGGTT No data
Right 1120330736 14:83090306-83090328 CTGTGGTCATTGGCTCCAGCAGG No data
1120330732_1120330736 14 Left 1120330732 14:83090269-83090291 CCCATGAAAGCTGCAGTTTGGGT No data
Right 1120330736 14:83090306-83090328 CTGTGGTCATTGGCTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120330736 Original CRISPR CTGTGGTCATTGGCTCCAGC AGG Intergenic
No off target data available for this crispr