ID: 1120350002

View in Genome Browser
Species Human (GRCh38)
Location 14:83342876-83342898
Sequence CACAGTGGGTACGCCCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120349998_1120350002 -10 Left 1120349998 14:83342863-83342885 CCAGAACAGGCCCCACAGTGGGT No data
Right 1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG No data
1120349989_1120350002 12 Left 1120349989 14:83342841-83342863 CCCCTTTCCAGTCCATAAAAACC No data
Right 1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG No data
1120349994_1120350002 0 Left 1120349994 14:83342853-83342875 CCATAAAAACCCAGAACAGGCCC No data
Right 1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG No data
1120349991_1120350002 10 Left 1120349991 14:83342843-83342865 CCTTTCCAGTCCATAAAAACCCA No data
Right 1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG No data
1120349996_1120350002 -9 Left 1120349996 14:83342862-83342884 CCCAGAACAGGCCCCACAGTGGG No data
Right 1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG No data
1120349990_1120350002 11 Left 1120349990 14:83342842-83342864 CCCTTTCCAGTCCATAAAAACCC No data
Right 1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG No data
1120349992_1120350002 5 Left 1120349992 14:83342848-83342870 CCAGTCCATAAAAACCCAGAACA No data
Right 1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120350002 Original CRISPR CACAGTGGGTACGCCCAATC AGG Intergenic
No off target data available for this crispr