ID: 1120354875

View in Genome Browser
Species Human (GRCh38)
Location 14:83419528-83419550
Sequence AGGCAGGTTGAACACCGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120354870_1120354875 18 Left 1120354870 14:83419487-83419509 CCAAGGCCTTTATTCACTCAGTA No data
Right 1120354875 14:83419528-83419550 AGGCAGGTTGAACACCGCTCTGG No data
1120354871_1120354875 12 Left 1120354871 14:83419493-83419515 CCTTTATTCACTCAGTAATTTTC No data
Right 1120354875 14:83419528-83419550 AGGCAGGTTGAACACCGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120354875 Original CRISPR AGGCAGGTTGAACACCGCTC TGG Intergenic
No off target data available for this crispr