ID: 1120356660

View in Genome Browser
Species Human (GRCh38)
Location 14:83442805-83442827
Sequence CAGGGTTAGGACTCTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120356652_1120356660 17 Left 1120356652 14:83442765-83442787 CCTGGTGCTGGTACTCCAGGAGC No data
Right 1120356660 14:83442805-83442827 CAGGGTTAGGACTCTGAAGAAGG No data
1120356655_1120356660 2 Left 1120356655 14:83442780-83442802 CCAGGAGCTCAGAGGAAGGACCT No data
Right 1120356660 14:83442805-83442827 CAGGGTTAGGACTCTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120356660 Original CRISPR CAGGGTTAGGACTCTGAAGA AGG Intergenic
No off target data available for this crispr