ID: 1120357329

View in Genome Browser
Species Human (GRCh38)
Location 14:83451293-83451315
Sequence TAGGGTATAGTGAAAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120357329_1120357337 12 Left 1120357329 14:83451293-83451315 CCTGGCCCTTTCACTATACCCTA No data
Right 1120357337 14:83451328-83451350 CTGAAAAAACAAGATTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120357329 Original CRISPR TAGGGTATAGTGAAAGGGCC AGG (reversed) Intergenic
No off target data available for this crispr