ID: 1120366775

View in Genome Browser
Species Human (GRCh38)
Location 14:83581349-83581371
Sequence ATAAACTATCTGGACAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120366775_1120366779 20 Left 1120366775 14:83581349-83581371 CCATTTTTGTCCAGATAGTTTAT No data
Right 1120366779 14:83581392-83581414 TAAACACCTGCTTTGAATCTAGG No data
1120366775_1120366777 -3 Left 1120366775 14:83581349-83581371 CCATTTTTGTCCAGATAGTTTAT No data
Right 1120366777 14:83581369-83581391 TATCCTAGTAATGTTATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120366775 Original CRISPR ATAAACTATCTGGACAAAAA TGG (reversed) Intergenic
No off target data available for this crispr