ID: 1120369136

View in Genome Browser
Species Human (GRCh38)
Location 14:83609608-83609630
Sequence GTTTCTAAGGAGATTCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120369132_1120369136 9 Left 1120369132 14:83609576-83609598 CCAGAAACCTGTACAGAGTAATC No data
Right 1120369136 14:83609608-83609630 GTTTCTAAGGAGATTCTGGTAGG No data
1120369131_1120369136 19 Left 1120369131 14:83609566-83609588 CCATAGGTCACCAGAAACCTGTA No data
Right 1120369136 14:83609608-83609630 GTTTCTAAGGAGATTCTGGTAGG No data
1120369133_1120369136 2 Left 1120369133 14:83609583-83609605 CCTGTACAGAGTAATCGAGAAAT No data
Right 1120369136 14:83609608-83609630 GTTTCTAAGGAGATTCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120369136 Original CRISPR GTTTCTAAGGAGATTCTGGT AGG Intergenic
No off target data available for this crispr