ID: 1120380545

View in Genome Browser
Species Human (GRCh38)
Location 14:83773502-83773524
Sequence CCATTAAAACAAAAAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120380545_1120380548 11 Left 1120380545 14:83773502-83773524 CCCAGTTCTTTTTGTTTTAATGG No data
Right 1120380548 14:83773536-83773558 AATCTGCTTGTTAAGAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120380545 Original CRISPR CCATTAAAACAAAAAGAACT GGG (reversed) Intergenic
No off target data available for this crispr