ID: 1120384569

View in Genome Browser
Species Human (GRCh38)
Location 14:83827896-83827918
Sequence CAGGTGTTTCAGAAAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120384569_1120384572 -6 Left 1120384569 14:83827896-83827918 CCTTGCCCTTTCTGAAACACCTG No data
Right 1120384572 14:83827913-83827935 CACCTGCCCTGACAGCTCCACGG No data
1120384569_1120384583 22 Left 1120384569 14:83827896-83827918 CCTTGCCCTTTCTGAAACACCTG No data
Right 1120384583 14:83827941-83827963 CACATGCAGAAGCAATGCCAGGG No data
1120384569_1120384582 21 Left 1120384569 14:83827896-83827918 CCTTGCCCTTTCTGAAACACCTG No data
Right 1120384582 14:83827940-83827962 CCACATGCAGAAGCAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120384569 Original CRISPR CAGGTGTTTCAGAAAGGGCA AGG (reversed) Intergenic
No off target data available for this crispr