ID: 1120385987

View in Genome Browser
Species Human (GRCh38)
Location 14:83846533-83846555
Sequence CAGCCTGCATGCCATACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120385986_1120385987 11 Left 1120385986 14:83846499-83846521 CCTTGGAAGTAGCTAGGGTCTTG No data
Right 1120385987 14:83846533-83846555 CAGCCTGCATGCCATACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120385987 Original CRISPR CAGCCTGCATGCCATACCAT TGG Intergenic
No off target data available for this crispr