ID: 1120386872

View in Genome Browser
Species Human (GRCh38)
Location 14:83857604-83857626
Sequence CTTAGGCAGGCACTTTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120386872_1120386877 30 Left 1120386872 14:83857604-83857626 CCAGCTTAAAGTGCCTGCCTAAG No data
Right 1120386877 14:83857657-83857679 TTTTTATTGTAACCAACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120386872 Original CRISPR CTTAGGCAGGCACTTTAAGC TGG (reversed) Intergenic
No off target data available for this crispr