ID: 1120386875

View in Genome Browser
Species Human (GRCh38)
Location 14:83857631-83857653
Sequence CAAATTATTTTGTCAACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120386875_1120386878 10 Left 1120386875 14:83857631-83857653 CCCAAAGTTGACAAAATAATTTG No data
Right 1120386878 14:83857664-83857686 TGTAACCAACACCTGGTGACAGG No data
1120386875_1120386877 3 Left 1120386875 14:83857631-83857653 CCCAAAGTTGACAAAATAATTTG No data
Right 1120386877 14:83857657-83857679 TTTTTATTGTAACCAACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120386875 Original CRISPR CAAATTATTTTGTCAACTTT GGG (reversed) Intergenic
No off target data available for this crispr