ID: 1120386878

View in Genome Browser
Species Human (GRCh38)
Location 14:83857664-83857686
Sequence TGTAACCAACACCTGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120386874_1120386878 20 Left 1120386874 14:83857621-83857643 CCTAAGAAAGCCCAAAGTTGACA No data
Right 1120386878 14:83857664-83857686 TGTAACCAACACCTGGTGACAGG No data
1120386875_1120386878 10 Left 1120386875 14:83857631-83857653 CCCAAAGTTGACAAAATAATTTG No data
Right 1120386878 14:83857664-83857686 TGTAACCAACACCTGGTGACAGG No data
1120386873_1120386878 24 Left 1120386873 14:83857617-83857639 CCTGCCTAAGAAAGCCCAAAGTT No data
Right 1120386878 14:83857664-83857686 TGTAACCAACACCTGGTGACAGG No data
1120386876_1120386878 9 Left 1120386876 14:83857632-83857654 CCAAAGTTGACAAAATAATTTGT No data
Right 1120386878 14:83857664-83857686 TGTAACCAACACCTGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120386878 Original CRISPR TGTAACCAACACCTGGTGAC AGG Intergenic
No off target data available for this crispr