ID: 1120389957

View in Genome Browser
Species Human (GRCh38)
Location 14:83893838-83893860
Sequence CAGGGTGACCTTGAAGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120389957_1120389961 23 Left 1120389957 14:83893838-83893860 CCATTCTCTTCAAGGTCACCCTG No data
Right 1120389961 14:83893884-83893906 TCTGATTGCCTCCTTTGGAAAGG 0: 188
1: 367
2: 385
3: 216
4: 288
1120389957_1120389960 18 Left 1120389957 14:83893838-83893860 CCATTCTCTTCAAGGTCACCCTG No data
Right 1120389960 14:83893879-83893901 GCATATCTGATTGCCTCCTTTGG 0: 248
1: 374
2: 342
3: 188
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120389957 Original CRISPR CAGGGTGACCTTGAAGAGAA TGG (reversed) Intergenic
No off target data available for this crispr