ID: 1120390382

View in Genome Browser
Species Human (GRCh38)
Location 14:83899701-83899723
Sequence CAGAGCTAAAGCACACATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120390379_1120390382 -5 Left 1120390379 14:83899683-83899705 CCAGGCAGATGGAAAATCCAGAG No data
Right 1120390382 14:83899701-83899723 CAGAGCTAAAGCACACATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120390382 Original CRISPR CAGAGCTAAAGCACACATGT GGG Intergenic
No off target data available for this crispr