ID: 1120397381

View in Genome Browser
Species Human (GRCh38)
Location 14:83985581-83985603
Sequence GCGCAAACAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120397381_1120397389 18 Left 1120397381 14:83985581-83985603 CCATCCACCACTGCTGTTTGCGC No data
Right 1120397389 14:83985622-83985644 GACTTCCATCCCTCTGGATCCGG 0: 25
1: 61
2: 115
3: 90
4: 155
1120397381_1120397392 23 Left 1120397381 14:83985581-83985603 CCATCCACCACTGCTGTTTGCGC No data
Right 1120397392 14:83985627-83985649 CCATCCCTCTGGATCCGGCAGGG 0: 12
1: 63
2: 139
3: 135
4: 201
1120397381_1120397390 22 Left 1120397381 14:83985581-83985603 CCATCCACCACTGCTGTTTGCGC No data
Right 1120397390 14:83985626-83985648 TCCATCCCTCTGGATCCGGCAGG No data
1120397381_1120397387 12 Left 1120397381 14:83985581-83985603 CCATCCACCACTGCTGTTTGCGC No data
Right 1120397387 14:83985616-83985638 ACCGCTGACTTCCATCCCTCTGG 0: 10
1: 44
2: 108
3: 118
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120397381 Original CRISPR GCGCAAACAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr