ID: 1120397665

View in Genome Browser
Species Human (GRCh38)
Location 14:83988394-83988416
Sequence GAAGAAGGAGCACCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120397665_1120397668 5 Left 1120397665 14:83988394-83988416 CCTCCTGGGGGTGCTCCTTCTTC No data
Right 1120397668 14:83988422-83988444 TACCCTGTACCCAAAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120397665 Original CRISPR GAAGAAGGAGCACCCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr