ID: 1120399816

View in Genome Browser
Species Human (GRCh38)
Location 14:84016472-84016494
Sequence CTGCTTTCATTGAACAACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120399816_1120399821 30 Left 1120399816 14:84016472-84016494 CCGGTGTTGTTCAATGAAAGCAG No data
Right 1120399821 14:84016525-84016547 TATTGAGCACAAAGCAGTCTGGG No data
1120399816_1120399817 -5 Left 1120399816 14:84016472-84016494 CCGGTGTTGTTCAATGAAAGCAG No data
Right 1120399817 14:84016490-84016512 AGCAGCACATGATCCAAAGCAGG No data
1120399816_1120399820 29 Left 1120399816 14:84016472-84016494 CCGGTGTTGTTCAATGAAAGCAG No data
Right 1120399820 14:84016524-84016546 GTATTGAGCACAAAGCAGTCTGG No data
1120399816_1120399818 -2 Left 1120399816 14:84016472-84016494 CCGGTGTTGTTCAATGAAAGCAG No data
Right 1120399818 14:84016493-84016515 AGCACATGATCCAAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120399816 Original CRISPR CTGCTTTCATTGAACAACAC CGG (reversed) Intergenic
No off target data available for this crispr