ID: 1120404526

View in Genome Browser
Species Human (GRCh38)
Location 14:84078418-84078440
Sequence CTGTTTGGACAAGTTAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120404511_1120404526 22 Left 1120404511 14:84078373-84078395 CCTTCCACTTTCTCCCTGACCCC No data
Right 1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG No data
1120404512_1120404526 18 Left 1120404512 14:84078377-84078399 CCACTTTCTCCCTGACCCCCTTT No data
Right 1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG No data
1120404517_1120404526 1 Left 1120404517 14:84078394-84078416 CCCTTTTCACTATCCCAACCCCT No data
Right 1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG No data
1120404516_1120404526 2 Left 1120404516 14:84078393-84078415 CCCCTTTTCACTATCCCAACCCC No data
Right 1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG No data
1120404515_1120404526 3 Left 1120404515 14:84078392-84078414 CCCCCTTTTCACTATCCCAACCC No data
Right 1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG No data
1120404513_1120404526 9 Left 1120404513 14:84078386-84078408 CCCTGACCCCCTTTTCACTATCC No data
Right 1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG No data
1120404510_1120404526 28 Left 1120404510 14:84078367-84078389 CCTGAACCTTCCACTTTCTCCCT No data
Right 1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG No data
1120404514_1120404526 8 Left 1120404514 14:84078387-84078409 CCTGACCCCCTTTTCACTATCCC No data
Right 1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG No data
1120404518_1120404526 0 Left 1120404518 14:84078395-84078417 CCTTTTCACTATCCCAACCCCTT No data
Right 1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120404526 Original CRISPR CTGTTTGGACAAGTTAAGGA TGG Intergenic
No off target data available for this crispr